Review



plko 1 scramble vector  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96

    Structured Review

    Addgene inc plko 1 scramble vector
    Plko 1 Scramble Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1090 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plko+1+scramble+shrna+vector/scramble+shRNA+(Plasmid+%231864)/pm41702885-72-1-4
    Average 96 stars, based on 1090 article reviews
    plko 1 scramble vector - by Bioz Stars, 2026-09
    96/100 stars

    Images

    Related Articles

    shRNA:

    Article Title: NF-κB p65 Subunit Is Modulated by Latent Transforming Growth Factor-β Binding Protein 2 (LTBP2) in Nasopharyngeal Carcinoma HONE1 and HK1 Cells
    Article Snippet: The p65- and IκBa-shRNA knockdown oligonucleotides, designed according to the RNAi consortium library [ ], were cloned into pLKO.1 TRC cloning vector (Addgene plasmid 10878). .. The sequences of the two shRNA oligonucleotides are shown in . pLKO.1-scramble shRNA vector (Addgene 1864) was used as a negative control. .. The IκBa- SR with three HA-tags was obtained from Addgene (24143) and subcloned into the pWPI system (Addgene plasmid 12254).

    Article Title: Novel Axl-driven signaling pathway and molecular signature characterize high-grade ovarian cancer patients with poor clinical outcome.
    Article Snippet: .. The pLKO.1 scramble shRNA vector (Addgene, Cambridge, MA, USA) was used as the negative control. ..

    Article Title: Tenascin-X promotes epithelial-to-mesenchymal transition by activating latent TGF-β
    Article Snippet: Cells were either transiently transfected with plasmids by means of Lipofectamine 2000 (Invitrogen; MNuMG and HT-1080 cells) or microporated (MCF10A and BL41-(CAGA) 9 -Luc cells) with the Neon Transfection System (Invitrogen) and an MP-100 microporator (Invitrogen), according to the manufacturer’s instructions. shRNAs targeting expression of the human ITGA11 gene (NM_001004439) were obtained by cloning the corresponding sequence (α11#1, 5′-CCGGGCCATCCAAGATCAACATCTTCTCGAGAAGATGTTGATCTTGGATGGCTTTTTG-3′; or α11#2, 5′-CCGGGCTGGAGAGATACGATGGTATCTCGAGATACCATCGTATCTCTCCAGCTTTTTG-3′) into the pLKO.1 TRC cloning vector (plasmid #10878; Addgene) between the EcoRI and AgeI sites. .. The pLKO.1 scramble shRNA vector (plasmid #1864; Addgene) was used as a control. .. The cDNA encoding the open reading frame of the human ITGA11 gene was amplified from human dermal fibroblast mRNA by RT-PCR using the PrimeSTAR HS DNA Polymerase and the following forward, 5′-AAAAAGCTTCGGGCCATGGACCTGCCC-3′, and reverse, 5′-TTTGAATTCTCACTCCAGCACTTTGGGGG-3′, oligonucleotides and cloned into the pcDNA3 vector (Invitrogen) between the HindIII and EcoRI sites.

    Article Title: The Forkhead Transcription Factor FOXC2 Is Required for Maintaining Murine Spermatogonial Stem Cells.
    Article Snippet: St em C el ls an d De ve lo pm en t Th e Fo rk he ad T ra ns cr ip tio n Fa ct or F OX C2 is R eq ui re d fo r M ai nt ai ni ng M ur in e Sp er m at og on ia l S te m C el ls (D OI : 1 0.. 10 89 /s cd .2 01 7.. 02 33 ) Th is pa pe r h as b ee n pe er ‐re vi ew ed a nd a cc ep te d fo r p ub lic at io n, b ut h as y et to u nd er go co py ed iti ng a nd p ro of co rr ec tio n. T he fi na l p ub lis he d ve rs io n m ay d iff er fr om th is pr oo f. Continuous spermatogenesis from puberty to old age in males relies on spermatogonial stem cells (SSCs) that possess the property of self‐renewal and differentiation.

    Article Title: Novel Axl-driven signaling pathway and molecular signature characterize high-grade ovarian cancer patients with poor clinical outcome
    Article Snippet: .. The pLKO.1 scramble shRNA vector (Addgene, Cambridge, MA, USA) was used as the negative control. ..

    Article Title: p130Cas scaffold protein regulates ErbB2 stability by altering breast cancer cell sensitivity to autophagy
    Article Snippet: .. A pLKO.1 lentiviral vector carrying a shRNA directed to human p130Cas (p130Cas shRNA) was selected in the pLKO.1 target gene shRNA set (clone ID TRCN0000115985), purchased from Open Biosystem (Huntsville, AL, USA, http://www.thermoscientificbio.com ). pLKO.1 scramble shRNA vector (Addgene, Cambridge, MA, USA, http://www.addgene.com ) was used as negative control. ..

    Article Title: Mouse Stbd1 is N -myristoylated and affects ER–mitochondria association and mitochondrial morphology
    Article Snippet: The following oligonucleotides containing a short hairpin for Stbd1 (shStbd1) were annealed and cloned in pLKO.1-TRC (Addgene plasmid #10878, deposited by David Root) , at AgeI-EcoRI restriction sites: forward, 5′-CCGGGAAGAATGCAGCAATAGATTCCTCGAGGAATCTATTGCTGCATTCTTCTTTTTG-3′; reverse, 5′-AATTCAAAAAGAAGAATGCAGCAATAGATTCCTCGAGGAATCTATTGCTGCATTCTTC-3′. .. A pLKO.1-scramble shRNA vector (Addgene plasmid #1864, deposited by David Sabatini) , was used as control. .. Lentiviral particles were produced in HEK293T cells following co-transfection of shStbd1 or shScramble vector with the accessory vectors pMD2.G and psPAX2 (Addgene plasmids #12259 and #12260, respectively, deposited by Didier Trono).

    Article Title: Pancreatic cancer counterattack: MUC4 mediates Fas-independent apoptosis of antigen-specific cytotoxic T lymphocyte.
    Article Snippet: .. The pLKO.1-scramble shRNA vector (Addgene ID #1864; negative control vector containing scrambled shRNA insert) was used to package virus and infect HPACs as control. .. Stable clones were then selected in a medium containing puromycin (5 μg/ml; Sigma).

    Plasmid Preparation:

    Article Title: NF-κB p65 Subunit Is Modulated by Latent Transforming Growth Factor-β Binding Protein 2 (LTBP2) in Nasopharyngeal Carcinoma HONE1 and HK1 Cells
    Article Snippet: The p65- and IκBa-shRNA knockdown oligonucleotides, designed according to the RNAi consortium library [ ], were cloned into pLKO.1 TRC cloning vector (Addgene plasmid 10878). .. The sequences of the two shRNA oligonucleotides are shown in . pLKO.1-scramble shRNA vector (Addgene 1864) was used as a negative control. .. The IκBa- SR with three HA-tags was obtained from Addgene (24143) and subcloned into the pWPI system (Addgene plasmid 12254).

    Article Title: Tenascin-X promotes epithelial-to-mesenchymal transition by activating latent TGF-β
    Article Snippet: Cells were either transiently transfected with plasmids by means of Lipofectamine 2000 (Invitrogen; MNuMG and HT-1080 cells) or microporated (MCF10A and BL41-(CAGA) 9 -Luc cells) with the Neon Transfection System (Invitrogen) and an MP-100 microporator (Invitrogen), according to the manufacturer’s instructions. shRNAs targeting expression of the human ITGA11 gene (NM_001004439) were obtained by cloning the corresponding sequence (α11#1, 5′-CCGGGCCATCCAAGATCAACATCTTCTCGAGAAGATGTTGATCTTGGATGGCTTTTTG-3′; or α11#2, 5′-CCGGGCTGGAGAGATACGATGGTATCTCGAGATACCATCGTATCTCTCCAGCTTTTTG-3′) into the pLKO.1 TRC cloning vector (plasmid #10878; Addgene) between the EcoRI and AgeI sites. .. The pLKO.1 scramble shRNA vector (plasmid #1864; Addgene) was used as a control. .. The cDNA encoding the open reading frame of the human ITGA11 gene was amplified from human dermal fibroblast mRNA by RT-PCR using the PrimeSTAR HS DNA Polymerase and the following forward, 5′-AAAAAGCTTCGGGCCATGGACCTGCCC-3′, and reverse, 5′-TTTGAATTCTCACTCCAGCACTTTGGGGG-3′, oligonucleotides and cloned into the pcDNA3 vector (Invitrogen) between the HindIII and EcoRI sites.

    Article Title: The Forkhead Transcription Factor FOXC2 Is Required for Maintaining Murine Spermatogonial Stem Cells.
    Article Snippet: St em C el ls an d De ve lo pm en t Th e Fo rk he ad T ra ns cr ip tio n Fa ct or F OX C2 is R eq ui re d fo r M ai nt ai ni ng M ur in e Sp er m at og on ia l S te m C el ls (D OI : 1 0.. 10 89 /s cd .2 01 7.. 02 33 ) Th is pa pe r h as b ee n pe er ‐re vi ew ed a nd a cc ep te d fo r p ub lic at io n, b ut h as y et to u nd er go co py ed iti ng a nd p ro of co rr ec tio n. T he fi na l p ub lis he d ve rs io n m ay d iff er fr om th is pr oo f. Continuous spermatogenesis from puberty to old age in males relies on spermatogonial stem cells (SSCs) that possess the property of self‐renewal and differentiation.

    Article Title: Mouse Stbd1 is N -myristoylated and affects ER–mitochondria association and mitochondrial morphology
    Article Snippet: The following oligonucleotides containing a short hairpin for Stbd1 (shStbd1) were annealed and cloned in pLKO.1-TRC (Addgene plasmid #10878, deposited by David Root) , at AgeI-EcoRI restriction sites: forward, 5′-CCGGGAAGAATGCAGCAATAGATTCCTCGAGGAATCTATTGCTGCATTCTTCTTTTTG-3′; reverse, 5′-AATTCAAAAAGAAGAATGCAGCAATAGATTCCTCGAGGAATCTATTGCTGCATTCTTC-3′. .. A pLKO.1-scramble shRNA vector (Addgene plasmid #1864, deposited by David Sabatini) , was used as control. .. Lentiviral particles were produced in HEK293T cells following co-transfection of shStbd1 or shScramble vector with the accessory vectors pMD2.G and psPAX2 (Addgene plasmids #12259 and #12260, respectively, deposited by Didier Trono).

    Negative Control:

    Article Title: NF-κB p65 Subunit Is Modulated by Latent Transforming Growth Factor-β Binding Protein 2 (LTBP2) in Nasopharyngeal Carcinoma HONE1 and HK1 Cells
    Article Snippet: The p65- and IκBa-shRNA knockdown oligonucleotides, designed according to the RNAi consortium library [ ], were cloned into pLKO.1 TRC cloning vector (Addgene plasmid 10878). .. The sequences of the two shRNA oligonucleotides are shown in . pLKO.1-scramble shRNA vector (Addgene 1864) was used as a negative control. .. The IκBa- SR with three HA-tags was obtained from Addgene (24143) and subcloned into the pWPI system (Addgene plasmid 12254).

    Article Title: Novel Axl-driven signaling pathway and molecular signature characterize high-grade ovarian cancer patients with poor clinical outcome.
    Article Snippet: .. The pLKO.1 scramble shRNA vector (Addgene, Cambridge, MA, USA) was used as the negative control. ..

    Article Title: Novel Axl-driven signaling pathway and molecular signature characterize high-grade ovarian cancer patients with poor clinical outcome
    Article Snippet: .. The pLKO.1 scramble shRNA vector (Addgene, Cambridge, MA, USA) was used as the negative control. ..

    Article Title: p130Cas scaffold protein regulates ErbB2 stability by altering breast cancer cell sensitivity to autophagy
    Article Snippet: .. A pLKO.1 lentiviral vector carrying a shRNA directed to human p130Cas (p130Cas shRNA) was selected in the pLKO.1 target gene shRNA set (clone ID TRCN0000115985), purchased from Open Biosystem (Huntsville, AL, USA, http://www.thermoscientificbio.com ). pLKO.1 scramble shRNA vector (Addgene, Cambridge, MA, USA, http://www.addgene.com ) was used as negative control. ..

    Article Title: Pancreatic cancer counterattack: MUC4 mediates Fas-independent apoptosis of antigen-specific cytotoxic T lymphocyte.
    Article Snippet: .. The pLKO.1-scramble shRNA vector (Addgene ID #1864; negative control vector containing scrambled shRNA insert) was used to package virus and infect HPACs as control. .. Stable clones were then selected in a medium containing puromycin (5 μg/ml; Sigma).

    Control:

    Article Title: Tenascin-X promotes epithelial-to-mesenchymal transition by activating latent TGF-β
    Article Snippet: Cells were either transiently transfected with plasmids by means of Lipofectamine 2000 (Invitrogen; MNuMG and HT-1080 cells) or microporated (MCF10A and BL41-(CAGA) 9 -Luc cells) with the Neon Transfection System (Invitrogen) and an MP-100 microporator (Invitrogen), according to the manufacturer’s instructions. shRNAs targeting expression of the human ITGA11 gene (NM_001004439) were obtained by cloning the corresponding sequence (α11#1, 5′-CCGGGCCATCCAAGATCAACATCTTCTCGAGAAGATGTTGATCTTGGATGGCTTTTTG-3′; or α11#2, 5′-CCGGGCTGGAGAGATACGATGGTATCTCGAGATACCATCGTATCTCTCCAGCTTTTTG-3′) into the pLKO.1 TRC cloning vector (plasmid #10878; Addgene) between the EcoRI and AgeI sites. .. The pLKO.1 scramble shRNA vector (plasmid #1864; Addgene) was used as a control. .. The cDNA encoding the open reading frame of the human ITGA11 gene was amplified from human dermal fibroblast mRNA by RT-PCR using the PrimeSTAR HS DNA Polymerase and the following forward, 5′-AAAAAGCTTCGGGCCATGGACCTGCCC-3′, and reverse, 5′-TTTGAATTCTCACTCCAGCACTTTGGGGG-3′, oligonucleotides and cloned into the pcDNA3 vector (Invitrogen) between the HindIII and EcoRI sites.

    Article Title: Mouse Stbd1 is N -myristoylated and affects ER–mitochondria association and mitochondrial morphology
    Article Snippet: The following oligonucleotides containing a short hairpin for Stbd1 (shStbd1) were annealed and cloned in pLKO.1-TRC (Addgene plasmid #10878, deposited by David Root) , at AgeI-EcoRI restriction sites: forward, 5′-CCGGGAAGAATGCAGCAATAGATTCCTCGAGGAATCTATTGCTGCATTCTTCTTTTTG-3′; reverse, 5′-AATTCAAAAAGAAGAATGCAGCAATAGATTCCTCGAGGAATCTATTGCTGCATTCTTC-3′. .. A pLKO.1-scramble shRNA vector (Addgene plasmid #1864, deposited by David Sabatini) , was used as control. .. Lentiviral particles were produced in HEK293T cells following co-transfection of shStbd1 or shScramble vector with the accessory vectors pMD2.G and psPAX2 (Addgene plasmids #12259 and #12260, respectively, deposited by Didier Trono).

    Article Title: Pancreatic cancer counterattack: MUC4 mediates Fas-independent apoptosis of antigen-specific cytotoxic T lymphocyte.
    Article Snippet: .. The pLKO.1-scramble shRNA vector (Addgene ID #1864; negative control vector containing scrambled shRNA insert) was used to package virus and infect HPACs as control. .. Stable clones were then selected in a medium containing puromycin (5 μg/ml; Sigma).

    Virus:

    Article Title: Pancreatic cancer counterattack: MUC4 mediates Fas-independent apoptosis of antigen-specific cytotoxic T lymphocyte.
    Article Snippet: .. The pLKO.1-scramble shRNA vector (Addgene ID #1864; negative control vector containing scrambled shRNA insert) was used to package virus and infect HPACs as control. .. Stable clones were then selected in a medium containing puromycin (5 μg/ml; Sigma).



    Similar Products

    96
    Addgene inc plko 1 scramble vector
    Plko 1 Scramble Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plko+1+scramble+shrna+vector/scramble+shRNA+(Plasmid+%231864)/pm41702885-72-1-4
    Average 96 stars, based on 1 article reviews
    plko 1 scramble vector - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    Addgene inc nontargeting scramble shrna sequence oligonucleotide gcgcgatagcgctaataattt
    Nontargeting Scramble Shrna Sequence Oligonucleotide Gcgcgatagcgctaataattt, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plko+1+scramble+shrna+vector/pLKO%2E1+-+TRC+cloning+vector+(Plasmid+%2310878)/pm41339559-650-18-29
    Average 96 stars, based on 1 article reviews
    nontargeting scramble shrna sequence oligonucleotide gcgcgatagcgctaataattt - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    93
    Addgene inc plko 1 scrambled control shrna vector
    Plko 1 Scrambled Control Shrna Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plko+1+scramble+shrna+vector/PLKO%2E1-Scrambled+(Plasmid+%23136035)/pm40921794-168-20-27
    Average 93 stars, based on 1 article reviews
    plko 1 scrambled control shrna vector - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc scramble shrna control vector
    Scramble Shrna Control Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plko+1+scramble+shrna+vector/PLKO%2E1-Scrambled+(Plasmid+%23136035)/pmc12358835__pnas%2E2425621122%2Esapp-30-1-5
    Average 93 stars, based on 1 article reviews
    scramble shrna control vector - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    96
    OriGene pgfp plko 1 plasmids
    Pgfp Plko 1 Plasmids, supplied by OriGene, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plko+1+scramble+shrna+vector/Scrambled+shRNA+control+in+pGFP-C-shLenti+shRNA+Vector/ppr0852086-123-20-29
    Average 96 stars, based on 1 article reviews
    pgfp plko 1 plasmids - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    Addgene inc plko 1 vector scramble shrna
    Plko 1 Vector Scramble Shrna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plko+1+scramble+shrna+vector/scramble+shRNA+(Plasmid+%231864)/pm37646174-291-1-11
    Average 96 stars, based on 1 article reviews
    plko 1 vector scramble shrna - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    Addgene inc shrna vectors plko 1
    Shrna Vectors Plko 1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plko+1+scramble+shrna+vector/scramble+shRNA+(Plasmid+%231864)/pm37890608-42-9-13
    Average 96 stars, based on 1 article reviews
    shrna vectors plko 1 - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    Image Search Results